SubtiBank SubtiBank
Version comparison:

2019-03-19 18:49:292025-05-15 15:52:40

locus

BSU16940

BSU_16940

outlinks

bsu

BSU16940

BSU_16940

Gene

Phenotypes of a mutant

slower growth [Pubmed|26930481]

drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]

reduced [SW|sporulation] efficiency [Pubmed|26930481]

strongly reduced chromosomal transformation rate [Pubmed|23779106,22373918]

no amplification of the [[gene|gltA]]-[[gene|gltB]] chromosomal region to suppress the glutamate auxotrophy of a [[gene|gltC]] mutant [pubmed|28294562]

sensitive to Cr(VI) treatment [pubmed|30745368]

slower growth [Pubmed|26930481]

drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]

reduced [SW|sporulation] efficiency [Pubmed|26930481]

strongly reduced chromosomal transformation rate [Pubmed|23779106,22373918]

no amplification of the [[gene|gltA]]-[[gene|gltB]] chromosomal region to suppress the glutamate auxotrophy of a [[gene|gltC]] mutant [pubmed|28294562]

sensitive to Cr(VI) treatment [pubmed|30745368]

reduced resistance towards electron beams [pubmed|31948638]

reduced viability of a [[gene|rarA]] [[gene|recA]] double mutant [pubmed|32117122]

suppression of lethality of [[gene|pcrA]] inactivation [pubmed|32793628]

The protein

Catalyzed reaction/ biological activity

RecA stimulates ssDNA phosphorylase activity of [[protein|PnpA]] [Pubmed|21859751]

RecA-ATP in concert with [[protein|DprA]] and [[protein|SsbA]] catalyzes DNA strand exchange, with [[protein|SsbB]] as an accessory factor [Pubmed|25138221]

RecA-dATP catalyzes strand exchange even in the absence of the accessory factors [Pubmed|25138221]

protects sporulating cells from DNA damage [Pubmed|26930481]

RecA stimulates ssDNA phosphorylase activity of [[protein|PnpA]] [Pubmed|21859751]

RecA-ATP in concert with [[protein|DprA]] and [[protein|SsbA]] catalyzes DNA strand exchange, with [[protein|SsbB]] as an accessory factor [Pubmed|25138221]

RecA-dATP catalyzes strand exchange even in the absence of the accessory factors [Pubmed|25138221]

protects sporulating cells from DNA damage [Pubmed|26930481]

contributes to transfection with naked phage DNA [pubmed|31876108]

[[protein|RecA]] polymerized on tailed SPP1 duplex intermediates invades a homologous region in another incomplete molecule, and in concert with [[protein|RecD2]] helicase, reconstitutes a complete linear phage genome with redundant regions at the ends of the molecule [pubmed|31876108]

The protein

Protein family

recA family (according to Swiss-Prot)

RecA family (together with [[protein|RadA]]) (according to UniProt)

The protein

Effectors of protein activity

[[protein|RecO]] and [[protein|DprA]] provide [[protein|RecA]] access to ssDNA during chromosomal transformation [Pubmed|22373918]

[[protein|RecO]] and [[protein|DprA]] provide [[protein|RecA]] access to ssDNA during chromosomal transformation [Pubmed|22373918]

interaction with [[protein|DisA]] inhibits [[protein|RecA]] filament growth and [[protein|RecA]]-mediated DNA strand exchange [pubmed|30916351]

The protein

Structure

[PDB|1U94] (RecA from ''E. coli'', 62% identity, 86% similarity)

[PDB|1UBC] (RecA from ''Mycobacterium smegmatis'', 67% identity) [pubmed|12837805]

Biological materials

Mutant

IRN444 (cat), available in [SW|Jörg Stülke]'s lab

GP2542([[gene|recA]]::spc trpC2), available in [SW|Jörg Stülke]'s lab

1A746 (''recA''::''erm''), [Pubmed|1391055], available at the [http://bgsc.org/getdetail.php?bgscid=1A746 Bacillus Genetic Stock Center]

1A786 (''recA''::''kan''), [Pubmed|11208805], available at the [http://bgsc.org/getdetail.php?bgscid=1A786 Bacillus Genetic Stock Center]

BP469 (''recA''::''erm''), available in [SW|Fabian Commichau]'s lab

BKE16940 (''[[gene|recA]]''::''erm'', available in the [http://bgsc.org/ Bacillus Genetic Stock Center], in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s labs) [pubmed|28189581]

BKE16940 ([[gene|recA]]::erm [[gene|trpC2]]) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA

BKK16940 ([[gene|recA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA

IRN444 (cat), available in [SW|Jörg Stülke]'s lab

GP2542(Δ[[gene|recA]]::spc trpC2), available in [SW|Jörg Stülke]'s lab

1A746 (Δ''recA''::''erm''), [Pubmed|1391055], available at the [http://bgsc.org/getdetail.php?bgscid=1A746 Bacillus Genetic Stock Center]

1A786 (Δ''recA''::''kan''), [Pubmed|11208805], available at the [http://bgsc.org/getdetail.php?bgscid=1A786 Bacillus Genetic Stock Center]

BP469 (Δ''recA''::''erm''), available in [SW|Fabian Commichau]'s lab

BKE16940 (''[[gene|recA]]''::''erm'', available in the [http://bgsc.org/ Bacillus Genetic Stock Center], in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s labs) [pubmed|28189581]

BKE16940 ([[gene|recA]]::erm [[gene|trpC2]]) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA

BKK16940 ([[gene|recA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA

References

Reviews

14527291, 12045091, 10506835, 14616075, 21517913, 23046409, 23380520, 22933559, 17364684

14527291, 12045091, 10506835, 14616075, 21517913, 23046409, 23380520, 22933559, 17364684, 26459995, 31950915, 32286623

References

Original publications

11814663, 16061691, 19060143, 17803906, 16024744, 17630974, 8226626, 11555642, 16479537, 19730681, 7690748, 17229847, 16267290, 20509597, 20723756, 17449621, 21278288, 22373918, 22517742, 23284295, 23536821, 21859751, 23634894, 23779106, 24285298, 24285298, 24373815, 15378759, 24362571, 8899710, 24670664, 24891441, 25138221, 25169108, 25939832, 26001966, 26786319, 26930481, 28294562, 28344191, 28911099, 30050509, 30254116, 30401797, 30745368, 30814990

11814663, 16061691, 19060143, 17803906, 16024744, 17630974, 8226626, 11555642, 16479537, 19730681, 7690748, 17229847, 16267290, 20509597, 20723756, 17449621, 21278288, 22373918, 22517742, 23284295, 23536821, 21859751, 23634894, 23779106, 24285298, 24285298, 24373815, 15378759, 24362571, 8899710, 24670664, 24891441, 25138221, 25169108, 25939832, 26001966, 26786319, 26930481, 28294562, 28344191, 28911099, 30050509, 30254116, 30401797, 30745368, 30814990, 30877841, 12837805, 30975899, 30916351, 31350886, 31876108, 31948638, 32117122, 32793628